MEGABLAST 2.2.15 [Oct-15-2006] Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: ss 272 sequences; 3,008,365 total letters Searching..................................................done Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome. (76 letters) Score E Sequences producing significant alignments: (bits) Value AE006789 AE006641 |AE006789| Sulfolobus solfataricus P2 section ... 26 2.3 AE006643 AE006641 |AE006643| Sulfolobus solfataricus P2 section ... 26 2.3 AE006861 AE006641 |AE006861| Sulfolobus solfataricus P2 section ... 24 9.1 AE006847 AE006641 |AE006847| Sulfolobus solfataricus P2 section ... 24 9.1 AE006840 AE006641 |AE006840| Sulfolobus solfataricus P2 section ... 24 9.1 AE006788 AE006641 |AE006788| Sulfolobus solfataricus P2 section ... 24 9.1 AE006741 AE006641 |AE006741| Sulfolobus solfataricus P2 section ... 24 9.1 AE006721 AE006641 |AE006721| Sulfolobus solfataricus P2 section ... 24 9.1 AE006667 AE006641 |AE006667| Sulfolobus solfataricus P2 section ... 24 9.1 >AE006789 AE006641 |AE006789| Sulfolobus solfataricus P2 section 148 of 272 of the complete genome. Length = 11428 Score = 26.3 bits (13), Expect = 2.3 Identities = 13/13 (100%) Strand = Plus / Plus Query: 26 acctcccttacaa 38 ||||||||||||| Sbjct: 1269 acctcccttacaa 1281 >AE006643 AE006641 |AE006643| Sulfolobus solfataricus P2 section 2 of 272 of the complete genome. Length = 10464 Score = 26.3 bits (13), Expect = 2.3 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 agctgggagagca 26 ||||||||||||| Sbjct: 5842 agctgggagagca 5854 >AE006861 AE006641 |AE006861| Sulfolobus solfataricus P2 section 220 of 272 of the complete genome. Length = 7320 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Plus Query: 6 attagctcagct 17 |||||||||||| Sbjct: 4775 attagctcagct 4786 >AE006847 AE006641 |AE006847| Sulfolobus solfataricus P2 section 206 of 272 of the complete genome. Length = 13274 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Plus Query: 23 agcacctccctt 34 |||||||||||| Sbjct: 10294 agcacctccctt 10305 >AE006840 AE006641 |AE006840| Sulfolobus solfataricus P2 section 199 of 272 of the complete genome. Length = 12983 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Minus Query: 24 gcacctccctta 35 |||||||||||| Sbjct: 8831 gcacctccctta 8820 >AE006788 AE006641 |AE006788| Sulfolobus solfataricus P2 section 147 of 272 of the complete genome. Length = 10565 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Plus Query: 11 ctcagctgggag 22 |||||||||||| Sbjct: 4308 ctcagctgggag 4319 >AE006741 AE006641 |AE006741| Sulfolobus solfataricus P2 section 100 of 272 of the complete genome. Length = 7766 Score = 24.3 bits (12), Expect = 9.1 Identities = 18/20 (90%) Strand = Plus / Minus Query: 12 tcagctgggagagcacctcc 31 |||||||||||| | ||||| Sbjct: 2872 tcagctgggagaactcctcc 2853 >AE006721 AE006641 |AE006721| Sulfolobus solfataricus P2 section 80 of 272 of the complete genome. Length = 9537 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Minus Query: 35 acaaggaggggg 46 |||||||||||| Sbjct: 5257 acaaggaggggg 5246 >AE006667 AE006641 |AE006667| Sulfolobus solfataricus P2 section 26 of 272 of the complete genome. Length = 10379 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Plus Query: 33 ttacaaggaggg 44 |||||||||||| Sbjct: 1729 ttacaaggaggg 1740 Database: ss Posted date: Oct 2, 2007 11:55 PM Number of letters in database: 3,008,365 Number of sequences in database: 272 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 0, Extension: 0 Number of Sequences: 272 Number of Hits to DB: 1,392,036 Number of extensions: 1280060 Number of successful extensions: 9 Number of sequences better than 10.0: 9 Number of HSP's gapped: 9 Number of HSP's successfully gapped: 9 Length of query: 76 Length of database: 3,008,365 Length adjustment: 14 Effective length of query: 62 Effective length of database: 3,004,557 Effective search space: 186282534 Effective search space used: 186282534 X1: 11 (21.8 bits) X2: 20 (39.6 bits) X3: 51 (101.1 bits) S1: 12 (24.3 bits) S2: 12 (24.3 bits)