BLASTN 2.2.15 [Oct-15-2006] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= gene_pyrd_ecoli (1011 letters) Database: all 884 sequences; 12,243,887 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE008746 AE006468 |AE008746| Salmonella typhimurium LT2, section... 807 0.0 AE008866 AE006468 |AE008866| Salmonella typhimurium LT2, section... 34 0.62 embl|AE006081|AE006081 Pasteurella multocida subsp. multocida st... 32 2.4 embl|AE006079|AE006079 Pasteurella multocida subsp. multocida st... 32 2.4 embl|AE006058|AE006058 Pasteurella multocida subsp. multocida st... 32 2.4 AE012424 AE008922 |AE012424| Xanthomonas campestris pv. campestr... 32 2.4 AE012322 AE008922 |AE012322| Xanthomonas campestris pv. campestr... 32 2.4 AE012105 AE008922 |AE012105| Xanthomonas campestris pv. campestr... 32 2.4 AE008728 AE006468 |AE008728| Salmonella typhimurium LT2, section... 32 2.4 AE008722 AE006468 |AE008722| Salmonella typhimurium LT2, section... 32 2.4 embl|AE006224|AE006224 Pasteurella multocida subsp. multocida st... 30 9.7 embl|AE006194|AE006194 Pasteurella multocida subsp. multocida st... 30 9.7 embl|AE006150|AE006150 Pasteurella multocida subsp. multocida st... 30 9.7 embl|AE006145|AE006145 Pasteurella multocida subsp. multocida st... 30 9.7 embl|AE006082|AE006082 Pasteurella multocida subsp. multocida st... 30 9.7 embl|AE006048|AE006048 Pasteurella multocida subsp. multocida st... 30 9.7 AE012545 AE008922 |AE012545| Xanthomonas campestris pv. campestr... 30 9.7 AE012531 AE008922 |AE012531| Xanthomonas campestris pv. campestr... 30 9.7 AE012456 AE008922 |AE012456| Xanthomonas campestris pv. campestr... 30 9.7 AE012447 AE008922 |AE012447| Xanthomonas campestris pv. campestr... 30 9.7 AE012419 AE008922 |AE012419| Xanthomonas campestris pv. campestr... 30 9.7 AE012364 AE008922 |AE012364| Xanthomonas campestris pv. campestr... 30 9.7 AE012306 AE008922 |AE012306| Xanthomonas campestris pv. campestr... 30 9.7 AE012282 AE008922 |AE012282| Xanthomonas campestris pv. campestr... 30 9.7 AE012198 AE008922 |AE012198| Xanthomonas campestris pv. campestr... 30 9.7 AE012141 AE008922 |AE012141| Xanthomonas campestris pv. campestr... 30 9.7 AE012140 AE008922 |AE012140| Xanthomonas campestris pv. campestr... 30 9.7 AE012125 AE008922 |AE012125| Xanthomonas campestris pv. campestr... 30 9.7 AE008916 AE006468 |AE008916| Salmonella typhimurium LT2, section... 30 9.7 AE008913 AE006468 |AE008913| Salmonella typhimurium LT2, section... 30 9.7 AE008884 AE006468 |AE008884| Salmonella typhimurium LT2, section... 30 9.7 AE008878 AE006468 |AE008878| Salmonella typhimurium LT2, section... 30 9.7 AE008867 AE006468 |AE008867| Salmonella typhimurium LT2, section... 30 9.7 AE008859 AE006468 |AE008859| Salmonella typhimurium LT2, section... 30 9.7 AE008831 AE006468 |AE008831| Salmonella typhimurium LT2, section... 30 9.7 AE008762 AE006468 |AE008762| Salmonella typhimurium LT2, section... 30 9.7 AE008737 AE006468 AE008738-AE008739 |AE008737| Salmonella typhim... 30 9.7 AE008707 AE006468 |AE008707| Salmonella typhimurium LT2, section... 30 9.7 >AE008746 AE006468 |AE008746| Salmonella typhimurium LT2, section 50 of 220 of the complete genome. Length = 22288 Score = 807 bits (407), Expect = 0.0 Identities = 860/1011 (85%) Strand = Plus / Plus Query: 1 atgtactaccccttcgttcgtaaagcccttttccagctcgatccagagcgcgctcatgag 60 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 184 atgtactatcccttcgttcgtaaagcccttttccagctcgatccagagcgcgctcatgaa 243 Query: 61 tttacttttcagcaattacgccgtattacaggaacgccgtttgaagcactggtgcggcag 120 ||||| ||||| ||||||||||| |||||||| |||||| | ||||| |||||||| ||| Sbjct: 244 tttacatttcaacaattacgccgcattacaggtacgccgctggaagcgctggtgcgccag 303 Query: 121 aaagtgcctgcgaaacctgttaactgcatgggcctgacgtttaaaaatccgcttggtctg 180 ||||| || | || || |||| ||||||||| || || ||||||||||| || || ||| Sbjct: 304 aaagtaccgacaaagccggttacctgcatgggacttacctttaaaaatccactggggctg 363 Query: 181 gcagccggtcttgataaagacggggagtgcattgacgcgttaggcgcgatgggatttgga 240 || |||||||| |||||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 364 gctgccggtctggataaagacggggagtgcatcgacgcgttaggcgcgatggggtttggc 423 Query: 241 tcgatcgagatcggtaccgtcacgccacgtccacagccaggtaatgacaagccgcgtctc 300 || | || ||||| ||||| ||||| || |||||||| ||||| || ||||||||||| Sbjct: 424 tccctggaaatcggcaccgtgacgccgcgcccacagccgggtaacgataagccgcgtctt 483 Query: 301 tttcgtctggtagatgccgaaggtttgatcaaccgtatgggctttaataatcttggcgtt 360 ||||||||||| ||||| |||||| ||||||| || ||||||||||||||||| ||||| Sbjct: 484 tttcgtctggtggatgctgaaggtctgatcaatcggatgggctttaataatctgggcgtc 543 Query: 361 gataacctcgtagagaacgtaaaaaaggcccattatgacggcgtcctgggtattaacatc 420 |||||||| || ||||| || ||||| ||||||| ||| || | ||||| ||||||||| Sbjct: 544 gataacctggtcgagaatgttaaaaaagcccattttgatggtattctgggaattaacatc 603 Query: 421 ggcaaaaataaagatacgccagtggagcagggcaaagatgactatctgatttgtatggaa 480 || ||||||||||||||||| || || | |||||||||||||| ||||||||||||||| Sbjct: 604 ggtaaaaataaagatacgcctgtcgaaaatggcaaagatgactacctgatttgtatggaa 663 Query: 481 aaaatctatgcctatgcgggatatatcgccatcaatatttcatcgccgaataccccagga 540 ||| ||||||| |||||||| ||||||||||| |||||||| ||||||||||| ||||| Sbjct: 664 aaagtctatgcttatgcgggttatatcgccattaatatttcttcgccgaatacgccaggg 723 Query: 541 ttacgcacgctgcaatatggtgaagcgctggatgatctcttaaccgcgattaaaaataag 600 |||| ||||| || ||||| || |||||||| ||||| ||||| || |||||||||||| Sbjct: 724 ctacgtacgctccagtatggcgatgcgctggacgatctgttaactgccattaaaaataag 783 Query: 601 caaaatgatttgcaagcgatgcaccataaatatgtgccgatcgcagtgaagatcgcgccg 660 ||||| ||| | || ||||| |||||||||||||||||| | ||||| |||||||||||| Sbjct: 784 caaaacgatcttcaggcgatccaccataaatatgtgccggtggcagtaaagatcgcgccg 843 Query: 661 gatctttctgaagaagaattgatccaggttgccgatagtttagttcgccataatattgat 720 ||||||| |||||||||||||||||||||||||||||| | |||| |||||||||||| Sbjct: 844 gatctttgtgaagaagaattgatccaggttgccgatagcctgcttcgtcataatattgat 903 Query: 721 ggcgttattgcaaccaataccacactcgatcgttctcttgttcagggaatgaaaaattgc 780 || || ||||| || |||||||| |||||||||||||| || || ||||||||||||||| Sbjct: 904 ggggtgattgcgacaaataccaccctcgatcgttctctggtacaaggaatgaaaaattgc 963 Query: 781 gatcaaaccggtggcttaagtggtcgtccgcttcagttaaaaagcaccgaaattattcgc 840 | ||||| || || |||||||| || || | || ||||||||||| |||||||||||| Sbjct: 964 cagcaaacggggggattaagtggccggccattacaattaaaaagcacagaaattattcgc 1023 Query: 841 cgcttgtcactggaattaaacggtcgcttaccgatcatcggtgttggcggcatcgactcg 900 || || || | ||| ||||| || | || || || ||||| || |||||||| ||||| Sbjct: 1024 cgtttatcccaggagttaaagggacaattgcctattatcggcgtcggcggcattgactca 1083 Query: 901 gttatcgctgcgcgtgaaaagattgctgcgggtgcctcactggtgcaaatttattctggt 960 |||||||| ||||| || ||||| || || || || | ||||| ||||||||||| || Sbjct: 1084 gttatcgccgcgcgcgagaagatagcggcaggagctacgctggtacaaatttattccggc 1143 Query: 961 tttatttttaaaggtccgccgctgattaaagaaatcgttacccatatctaa 1011 |||||||||||||| ||||| |||||||||||||||| || || |||||| Sbjct: 1144 tttatttttaaaggcccgccattgattaaagaaatcgtaacgcacatctaa 1194 >AE008866 AE006468 |AE008866| Salmonella typhimurium LT2, section 170 of 220 of the complete genome. Length = 20516 Score = 34.2 bits (17), Expect = 0.62 Identities = 17/17 (100%) Strand = Plus / Plus Query: 408 gggtattaacatcggca 424 ||||||||||||||||| Sbjct: 981 gggtattaacatcggca 997 >embl|AE006081|AE006081 Pasteurella multocida subsp. multocida str. Pm70 section 48 of 204 of the complete genome. Length = 11341 Score = 32.2 bits (16), Expect = 2.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 644 cagtgaagatcgcgcc 659 |||||||||||||||| Sbjct: 11186 cagtgaagatcgcgcc 11201 >embl|AE006079|AE006079 Pasteurella multocida subsp. multocida str. Pm70 section 46 of 204 of the complete genome. Length = 12522 Score = 32.2 bits (16), Expect = 2.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 518 tttcatcgccgaatac 533 |||||||||||||||| Sbjct: 6809 tttcatcgccgaatac 6824 >embl|AE006058|AE006058 Pasteurella multocida subsp. multocida str. Pm70 section 25 of 204 of the complete genome. Length = 10592 Score = 32.2 bits (16), Expect = 2.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 953 attctggttttatttt 968 |||||||||||||||| Sbjct: 4229 attctggttttatttt 4244 >AE012424 AE008922 |AE012424| Xanthomonas campestris pv. campestris str. ATCC 33913, section 332 of 460 of the complete genome. Length = 10203 Score = 32.2 bits (16), Expect = 2.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 886 ggcggcatcgactcgg 901 |||||||||||||||| Sbjct: 6271 ggcggcatcgactcgg 6256 >AE012322 AE008922 |AE012322| Xanthomonas campestris pv. campestris str. ATCC 33913, section 230 of 460 of the complete genome. Length = 10444 Score = 32.2 bits (16), Expect = 2.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 519 ttcatcgccgaatacc 534 |||||||||||||||| Sbjct: 3713 ttcatcgccgaatacc 3728 >AE012105 AE008922 |AE012105| Xanthomonas campestris pv. campestris str. ATCC 33913, section 13 of 460 of the complete genome. Length = 11990 Score = 32.2 bits (16), Expect = 2.4 Identities = 19/20 (95%) Strand = Plus / Minus Query: 39 cgatccagagcgcgctcatg 58 |||||| ||||||||||||| Sbjct: 4096 cgatccggagcgcgctcatg 4077 >AE008728 AE006468 |AE008728| Salmonella typhimurium LT2, section 36 of 220 of the complete genome. Length = 22636 Score = 32.2 bits (16), Expect = 2.4 Identities = 16/16 (100%) Strand = Plus / Minus Query: 319 gaaggtttgatcaacc 334 |||||||||||||||| Sbjct: 5279 gaaggtttgatcaacc 5264 >AE008722 AE006468 |AE008722| Salmonella typhimurium LT2, section 30 of 220 of the complete genome. Length = 20029 Score = 32.2 bits (16), Expect = 2.4 Identities = 16/16 (100%) Strand = Plus / Plus Query: 213 tgacgcgttaggcgcg 228 |||||||||||||||| Sbjct: 10449 tgacgcgttaggcgcg 10464 >embl|AE006224|AE006224 Pasteurella multocida subsp. multocida str. Pm70 section 191 of 204 of the complete genome. Length = 11215 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 661 gatctttctgaagaa 675 ||||||||||||||| Sbjct: 2591 gatctttctgaagaa 2605 >embl|AE006194|AE006194 Pasteurella multocida subsp. multocida str. Pm70 section 161 of 204 of the complete genome. Length = 10533 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 764 agggaatgaaaaatt 778 ||||||||||||||| Sbjct: 8016 agggaatgaaaaatt 8030 >embl|AE006150|AE006150 Pasteurella multocida subsp. multocida str. Pm70 section 117 of 204 of the complete genome. Length = 10723 Score = 30.2 bits (15), Expect = 9.7 Identities = 18/19 (94%) Strand = Plus / Plus Query: 593 aaaataagcaaaatgattt 611 |||||||||||||| |||| Sbjct: 1647 aaaataagcaaaataattt 1665 >embl|AE006145|AE006145 Pasteurella multocida subsp. multocida str. Pm70 section 112 of 204 of the complete genome. Length = 10173 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 593 aaaataagcaaaatg 607 ||||||||||||||| Sbjct: 5834 aaaataagcaaaatg 5848 >embl|AE006082|AE006082 Pasteurella multocida subsp. multocida str. Pm70 section 49 of 204 of the complete genome. Length = 10029 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 179 tggcagccggtcttg 193 ||||||||||||||| Sbjct: 1319 tggcagccggtcttg 1305 >embl|AE006048|AE006048 Pasteurella multocida subsp. multocida str. Pm70 section 15 of 204 of the complete genome. Length = 12232 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 586 gcgattaaaaataag 600 ||||||||||||||| Sbjct: 5359 gcgattaaaaataag 5373 >AE012545 AE008922 |AE012545| Xanthomonas campestris pv. campestris str. ATCC 33913, section 453 of 460 of the complete genome. Length = 11255 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 642 cgcagtgaagatcgc 656 ||||||||||||||| Sbjct: 3490 cgcagtgaagatcgc 3504 >AE012531 AE008922 |AE012531| Xanthomonas campestris pv. campestris str. ATCC 33913, section 439 of 460 of the complete genome. Length = 11870 Score = 30.2 bits (15), Expect = 9.7 Identities = 18/19 (94%) Strand = Plus / Minus Query: 517 atttcatcgccgaataccc 535 |||||| |||||||||||| Sbjct: 4709 atttcaccgccgaataccc 4691 >AE012456 AE008922 |AE012456| Xanthomonas campestris pv. campestris str. ATCC 33913, section 364 of 460 of the complete genome. Length = 10029 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 717 tgatggcgttattgc 731 ||||||||||||||| Sbjct: 8390 tgatggcgttattgc 8404 >AE012447 AE008922 |AE012447| Xanthomonas campestris pv. campestris str. ATCC 33913, section 355 of 460 of the complete genome. Length = 10029 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 125 tgcctgcgaaacctg 139 ||||||||||||||| Sbjct: 1075 tgcctgcgaaacctg 1061 >AE012419 AE008922 |AE012419| Xanthomonas campestris pv. campestris str. ATCC 33913, section 327 of 460 of the complete genome. Length = 3108 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 881 gtgttggcggcatcg 895 ||||||||||||||| Sbjct: 2786 gtgttggcggcatcg 2772 >AE012364 AE008922 |AE012364| Xanthomonas campestris pv. campestris str. ATCC 33913, section 272 of 460 of the complete genome. Length = 11146 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 680 tgatccaggttgccg 694 ||||||||||||||| Sbjct: 1266 tgatccaggttgccg 1280 >AE012306 AE008922 |AE012306| Xanthomonas campestris pv. campestris str. ATCC 33913, section 214 of 460 of the complete genome. Length = 11895 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 30 tttccagctcgatcc 44 ||||||||||||||| Sbjct: 10139 tttccagctcgatcc 10153 >AE012282 AE008922 |AE012282| Xanthomonas campestris pv. campestris str. ATCC 33913, section 190 of 460 of the complete genome. Length = 10659 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 634 gtgccgatcgcagtg 648 ||||||||||||||| Sbjct: 8282 gtgccgatcgcagtg 8296 >AE012198 AE008922 |AE012198| Xanthomonas campestris pv. campestris str. ATCC 33913, section 106 of 460 of the complete genome. Length = 12541 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 263 cgccacgtccacagc 277 ||||||||||||||| Sbjct: 11827 cgccacgtccacagc 11813 >AE012141 AE008922 |AE012141| Xanthomonas campestris pv. campestris str. ATCC 33913, section 49 of 460 of the complete genome. Length = 10246 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 565 gcgctggatgatctc 579 ||||||||||||||| Sbjct: 6011 gcgctggatgatctc 5997 >AE012140 AE008922 |AE012140| Xanthomonas campestris pv. campestris str. ATCC 33913, section 48 of 460 of the complete genome. Length = 13420 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 883 gttggcggcatcgac 897 ||||||||||||||| Sbjct: 11120 gttggcggcatcgac 11106 >AE012125 AE008922 |AE012125| Xanthomonas campestris pv. campestris str. ATCC 33913, section 33 of 460 of the complete genome. Length = 12110 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 635 tgccgatcgcagtga 649 ||||||||||||||| Sbjct: 4171 tgccgatcgcagtga 4185 >AE008916 AE006468 |AE008916| Salmonella typhimurium LT2, section 220 of 220 of the complete genome. Length = 13852 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 960 ttttatttttaaagg 974 ||||||||||||||| Sbjct: 8220 ttttatttttaaagg 8234 >AE008913 AE006468 |AE008913| Salmonella typhimurium LT2, section 217 of 220 of the complete genome. Length = 23457 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 954 ttctggttttatttt 968 ||||||||||||||| Sbjct: 119 ttctggttttatttt 133 >AE008884 AE006468 |AE008884| Salmonella typhimurium LT2, section 188 of 220 of the complete genome. Length = 21692 Score = 30.2 bits (15), Expect = 9.7 Identities = 18/19 (94%) Strand = Plus / Minus Query: 562 gaagcgctggatgatctct 580 ||||||||||||| ||||| Sbjct: 10271 gaagcgctggatgttctct 10253 >AE008878 AE006468 |AE008878| Salmonella typhimurium LT2, section 182 of 220 of the complete genome. Length = 22418 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 654 cgcgccggatctttc 668 ||||||||||||||| Sbjct: 11542 cgcgccggatctttc 11556 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 906 cgctgcgcgtgaaaa 920 ||||||||||||||| Sbjct: 14895 cgctgcgcgtgaaaa 14881 >AE008867 AE006468 |AE008867| Salmonella typhimurium LT2, section 171 of 220 of the complete genome. Length = 21910 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 45 agagcgcgctcatga 59 ||||||||||||||| Sbjct: 6747 agagcgcgctcatga 6761 >AE008859 AE006468 |AE008859| Salmonella typhimurium LT2, section 163 of 220 of the complete genome. Length = 23069 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 349 aatcttggcgttgat 363 ||||||||||||||| Sbjct: 158 aatcttggcgttgat 144 >AE008831 AE006468 |AE008831| Salmonella typhimurium LT2, section 135 of 220 of the complete genome. Length = 20642 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 919 aagattgctgcgggt 933 ||||||||||||||| Sbjct: 15259 aagattgctgcgggt 15273 >AE008762 AE006468 |AE008762| Salmonella typhimurium LT2, section 66 of 220 of the complete genome. Length = 21913 Score = 30.2 bits (15), Expect = 9.7 Identities = 18/19 (94%) Strand = Plus / Plus Query: 99 gtttgaagcactggtgcgg 117 |||| |||||||||||||| Sbjct: 21842 gttttaagcactggtgcgg 21860 >AE008737 AE006468 AE008738-AE008739 |AE008737| Salmonella typhimurium LT2, section 45 of 220 of the complete genome. Length = 65219 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Plus Query: 804 tcgtccgcttcagtt 818 ||||||||||||||| Sbjct: 38927 tcgtccgcttcagtt 38941 >AE008707 AE006468 |AE008707| Salmonella typhimurium LT2, section 15 of 220 of the complete genome. Length = 22026 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 655 gcgccggatctttct 669 ||||||||||||||| Sbjct: 10982 gcgccggatctttct 10968 Score = 30.2 bits (15), Expect = 9.7 Identities = 15/15 (100%) Strand = Plus / Minus Query: 957 tggttttatttttaa 971 ||||||||||||||| Sbjct: 21827 tggttttatttttaa 21813 Database: all Posted date: Nov 1, 2008 1:41 AM Number of letters in database: 12,243,887 Number of sequences in database: 884 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 884 Number of Hits to DB: 143,386 Number of extensions: 8134 Number of successful extensions: 41 Number of sequences better than 10.0: 38 Number of HSP's gapped: 40 Number of HSP's successfully gapped: 40 Length of query: 1011 Length of database: 12,243,887 Length adjustment: 17 Effective length of query: 994 Effective length of database: 12,228,859 Effective search space: 12155485846 Effective search space used: 12155485846 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits) S2: 15 (30.2 bits)