MEGABLAST 2.2.15 [Oct-15-2006] Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: ss 272 sequences; 3,008,365 total letters Searching..................................................done Query= U00096 U00096.2 Escherichia coli K12 MG1655, complete genome. (76 letters) Score E Sequences producing significant alignments: (bits) Value AE006646 AE006641 |AE006646| Sulfolobus solfataricus P2 section ... 32 0.038 AE006765 AE006641 |AE006765| Sulfolobus solfataricus P2 section ... 26 2.3 AE006751 AE006641 |AE006751| Sulfolobus solfataricus P2 section ... 26 2.3 AE006716 AE006641 |AE006716| Sulfolobus solfataricus P2 section ... 26 2.3 AE006824 AE006641 |AE006824| Sulfolobus solfataricus P2 section ... 24 9.1 AE006818 AE006641 |AE006818| Sulfolobus solfataricus P2 section ... 24 9.1 AE006816 AE006641 |AE006816| Sulfolobus solfataricus P2 section ... 24 9.1 AE006778 AE006641 |AE006778| Sulfolobus solfataricus P2 section ... 24 9.1 AE006756 AE006641 |AE006756| Sulfolobus solfataricus P2 section ... 24 9.1 AE006748 AE006641 |AE006748| Sulfolobus solfataricus P2 section ... 24 9.1 AE006738 AE006641 |AE006738| Sulfolobus solfataricus P2 section ... 24 9.1 AE006719 AE006641 |AE006719| Sulfolobus solfataricus P2 section ... 24 9.1 AE006690 AE006641 |AE006690| Sulfolobus solfataricus P2 section ... 24 9.1 AE006658 AE006641 |AE006658| Sulfolobus solfataricus P2 section ... 24 9.1 >AE006646 AE006641 |AE006646| Sulfolobus solfataricus P2 section 5 of 272 of the complete genome. Length = 7990 Score = 32.2 bits (16), Expect = 0.038 Identities = 19/20 (95%) Strand = Plus / Plus Query: 8 tagctcagttggtagagcgc 27 |||||||||||| ||||||| Sbjct: 7723 tagctcagttggcagagcgc 7742 >AE006765 AE006641 |AE006765| Sulfolobus solfataricus P2 section 124 of 272 of the complete genome. Length = 10284 Score = 26.3 bits (13), Expect = 2.3 Identities = 13/13 (100%) Strand = Plus / Plus Query: 32 ttggtaagggtga 44 ||||||||||||| Sbjct: 7379 ttggtaagggtga 7391 >AE006751 AE006641 |AE006751| Sulfolobus solfataricus P2 section 110 of 272 of the complete genome. Length = 10129 Score = 26.3 bits (13), Expect = 2.3 Identities = 13/13 (100%) Strand = Plus / Minus Query: 13 cagttggtagagc 25 ||||||||||||| Sbjct: 6887 cagttggtagagc 6875 >AE006716 AE006641 |AE006716| Sulfolobus solfataricus P2 section 75 of 272 of the complete genome. Length = 13396 Score = 26.3 bits (13), Expect = 2.3 Identities = 13/13 (100%) Strand = Plus / Plus Query: 8 tagctcagttggt 20 ||||||||||||| Sbjct: 8403 tagctcagttggt 8415 >AE006824 AE006641 |AE006824| Sulfolobus solfataricus P2 section 183 of 272 of the complete genome. Length = 13389 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Plus Query: 33 tggtaagggtga 44 |||||||||||| Sbjct: 8077 tggtaagggtga 8088 >AE006818 AE006641 |AE006818| Sulfolobus solfataricus P2 section 177 of 272 of the complete genome. Length = 10370 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Minus Query: 26 gcacccttggta 37 |||||||||||| Sbjct: 2223 gcacccttggta 2212 >AE006816 AE006641 |AE006816| Sulfolobus solfataricus P2 section 175 of 272 of the complete genome. Length = 10029 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Plus Query: 57 gaatctgcctat 68 |||||||||||| Sbjct: 3802 gaatctgcctat 3813 >AE006778 AE006641 |AE006778| Sulfolobus solfataricus P2 section 137 of 272 of the complete genome. Length = 10554 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Minus Query: 14 agttggtagagc 25 |||||||||||| Sbjct: 693 agttggtagagc 682 >AE006756 AE006641 |AE006756| Sulfolobus solfataricus P2 section 115 of 272 of the complete genome. Length = 10275 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Minus Query: 62 tgcctatcagca 73 |||||||||||| Sbjct: 6142 tgcctatcagca 6131 >AE006748 AE006641 |AE006748| Sulfolobus solfataricus P2 section 107 of 272 of the complete genome. Length = 11753 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Minus Query: 61 ctgcctatcagc 72 |||||||||||| Sbjct: 11021 ctgcctatcagc 11010 >AE006738 AE006641 |AE006738| Sulfolobus solfataricus P2 section 97 of 272 of the complete genome. Length = 10444 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Minus Query: 5 atatagctcagt 16 |||||||||||| Sbjct: 4979 atatagctcagt 4968 >AE006719 AE006641 |AE006719| Sulfolobus solfataricus P2 section 78 of 272 of the complete genome. Length = 13191 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Plus Query: 1 gctgatatagct 12 |||||||||||| Sbjct: 10461 gctgatatagct 10472 >AE006690 AE006641 |AE006690| Sulfolobus solfataricus P2 section 49 of 272 of the complete genome. Length = 10261 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Minus Query: 1 gctgatatagct 12 |||||||||||| Sbjct: 8339 gctgatatagct 8328 >AE006658 AE006641 |AE006658| Sulfolobus solfataricus P2 section 17 of 272 of the complete genome. Length = 11648 Score = 24.3 bits (12), Expect = 9.1 Identities = 12/12 (100%) Strand = Plus / Plus Query: 56 cgaatctgccta 67 |||||||||||| Sbjct: 9724 cgaatctgccta 9735 Database: ss Posted date: Oct 7, 2007 12:18 PM Number of letters in database: 3,008,365 Number of sequences in database: 272 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 0, Extension: 0 Number of Sequences: 272 Number of Hits to DB: 5308 Number of extensions: 227 Number of successful extensions: 14 Number of sequences better than 10.0: 14 Number of HSP's gapped: 14 Number of HSP's successfully gapped: 14 Length of query: 76 Length of database: 3,008,365 Length adjustment: 14 Effective length of query: 62 Effective length of database: 3,004,557 Effective search space: 186282534 Effective search space used: 186282534 X1: 11 (21.8 bits) X2: 20 (39.6 bits) X3: 51 (101.1 bits) S1: 12 (24.3 bits) S2: 12 (24.3 bits)