BLAST2.0 query receipt
Thanks. Your request has been filed with the following data:
Program: blastn
Database: epd_all
Number: 3149
e-mail:
Format: plain_text
Sequence: >unknown
CCCGGCCGGCGGGGAGGGGGAGCCCGCGGCCGGG
Processing, please wait...
blastall.remote -S sib-gm1.unil.ch -p blastn -d "epd_all " -i wwwtmp/sq.3149.txt -M blosum62 -K 0 -e 10 -G def -E def -f def -F "S;" -X def -v 50 -b 50 -g T -m 0 -I T -q -3 -r 1 -Q 1 -D 1 -J T |
Here are your search results:
SIB BLAST network server version 1.6 of November 26, 2002
compiled by GNU C version 2.96 20000731 (Red Hat Linux 7.3 2.96-113)
compiled on Jun 10 2003.
Welcome to the SIB BLAST Network Service (sib-gm1)
==============================================================================
Swiss Institute of Bioinformatics (SIB)
Ludwig Institute for Cancer Research (LICR)
Swiss Institute for Experimental Cancer Research (ISREC)
==============================================================================
If results of this search are reported or published, please mention that
the computation was performed at the SIB using the BLAST network service.
PEPTIDE SEQUENCE DATABASES
swiss SwissProt + updates 24-May-2006
swisstrembl SwissProt + Trembl + updates 24-May-2006
nr Non-redundant SP + Trembl + EnsEMBL 24-May-2006
shuffled SwissProt r30 shuffled in windows of 20 aa
yeast S.cerevisiae translated genome ORFs
NUCLEOTIDE SEQUENCE DATABASES
embre * EMBL Data Library, Release 86, March 2006
embu * EmblUpdate 23-May-2006
embl * EMBL+EmblUpdate 23-May-2006
nr * Synonym to embl (and actually redundant). 23-May-2006
EST Database of Expressed Sequence Tags 23-May-2006
GSS Genome Survey Sequences 23-May-2006
HTG High-thruput Genomic Sequences 23-May-2006
WGS Whole Genome Shotgun Sequences 23-May-2006
STS Database of Sequence Tagged Sites 23-May-2006
repbase Repbase, January 07, 2005
simple Simple sequence repeats (J. Mol. Evol. 40:120, 1995)
yeast S.cerevisiae genome
worm C.elegans genome
* The est, gss, htg, wgs, and sts divisions of EMBL are excluded from these databases.
============================================================================
The BLAST Network Service uses a server developed by Paracel Inc. and the
Paracel BLAST software which is an enhancement of NCBI BLAST.
For problems regarding this site, please contact one of the following persons:
- problems with the programs: Christian Iseli (chris@cmpteam4.unil.ch)
Giovanna Ambrosini (giovanna.ambrosini@isb-sib.ch)
- problems with the databases: Victor Jongeneel (Victor.Jongeneel@isb-sib.ch)
Laurent Falquet (Laurent.Falquet@isrec.unil.ch)
============================================================================
Starting job.
BLASTN 1.5.4-Paracel [2003-06-05]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= unknown
(34 letters)
Database: epd; epd_bulk
17,856 sequences; 285,696,000 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
EP31007(+) Hs HMG-14; range -9999 to 6000. 68 2e-11
EP02025(+) Os AK060876; range -9999 to 6000. 38 0.017
EP03242(+) Os AK065245; range -9999 to 6000. 36 0.066
EP01641(+) Os AK121114; range -9999 to 6000. 36 0.066
EP12097(+) Os AK121236; range -9999 to 6000. 34 0.26
EP11440(+) Os AK062250; range -9999 to 6000. 34 0.26
EP11310(+) Os AK073072; range -9999 to 6000. 34 0.26
EP04549(+) Os AK072826; range -9999 to 6000. 34 0.26
EP00560(+) Os AK069317; range -9999 to 6000. 34 0.26
EP13370(+) Os AK065945; range -9999 to 6000. 32 1.0
EP12507(+) Os AK060693; range -9999 to 6000. 32 1.0
EP12371(+) Os AK059451; range -9999 to 6000. 32 1.0
EP11961(+) Os AK120318; range -9999 to 6000. 32 1.0
EP10967(+) Os AK068200; range -9999 to 6000. 32 1.0
EP10028(+) Os AK108849; range -9999 to 6000. 32 1.0
EP09645(+) Os AK067786; range -9999 to 6000. 32 1.0
EP09320(+) Os AK101631; range -9999 to 6000. 32 1.0
EP07644(+) Os AK065427; range -9999 to 6000. 32 1.0
EP06820(+) Os AK119782; range -9999 to 6000. 32 1.0
EP06694(+) Os AK069422; range -9999 to 6000. 32 1.0
EP05795(+) Os AK067089; range -9999 to 6000. 32 1.0
EP05768(+) Os AK065076; range -9999 to 6000. 32 1.0
EP05758(+) Os AK103812; range -9999 to 6000. 32 1.0
EP05728(+) Os AK100054; range -9999 to 6000. 32 1.0
EP05499(+) Os AK063364; range -9999 to 6000. 32 1.0
EP05430(+) Os AK070498; range -9999 to 6000. 32 1.0
EP05039(+) Os AK070924; range -9999 to 6000. 32 1.0
EP04972(+) Os AK106231; range -9999 to 6000. 32 1.0
EP04958(+) Os AK059827; range -9999 to 6000. 32 1.0
EP03823(+) Os AK063727; range -9999 to 6000. 32 1.0
EP03293(+) Os AK061747; range -9999 to 6000. 32 1.0
EP03249(+) Os AK060100; range -9999 to 6000. 32 1.0
EP02783(+) Os AK070181; range -9999 to 6000. 32 1.0
EP02731(+) Os AK107501; range -9999 to 6000. 32 1.0
EP02297(+) Os AK102861; range -9999 to 6000. 32 1.0
EP01771(+) Os AK060541; range -9999 to 6000. 32 1.0
EP01273(+) Os AK059858; range -9999 to 6000. 32 1.0
EP00944(+) Os AK064975; range -9999 to 6000. 32 1.0
EP00781(+) Os AK100623; range -9999 to 6000. 32 1.0
EP00559(+) Os AK070121; range -9999 to 6000. 32 1.0
EP73556(+) Hs HIF1A; range -9999 to 6000. 32 1.0
EP73097(+) Hs HSPCA; range -9999 to 6000. 32 1.0
EP13369(+) Os AK065943; range -9999 to 6000. 30 4.1
EP13232(+) Os AK064643; range -9999 to 6000. 30 4.1
EP13203(+) Os AK064565; range -9999 to 6000. 30 4.1
EP13134(+) Os AK064379; range -9999 to 6000. 30 4.1
EP12931(+) Os AK063437; range -9999 to 6000. 30 4.1
EP12283(+) Os AK058648; range -9999 to 6000. 30 4.1
EP12026(+) Os AK120762; range -9999 to 6000. 30 4.1
EP11943(+) Os AK120176; range -9999 to 6000. 30 4.1
>EP31007(+) Hs HMG-14; range -9999 to 6000.
Length = 16000
Score = 67.9 bits (34), Expect = 2e-11
Identities = 34/34 (100%)
Strand = Plus / Plus
Query: 1 cccggccggcggggagggggagcccgcggccggg 34
||||||||||||||||||||||||||||||||||
Sbjct: 9958 cccggccggcggggagggggagcccgcggccggg 9991
>EP02025(+) Os AK060876; range -9999 to 6000.
Length = 16000
Score = 38.2 bits (19), Expect = 0.017
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 1 cccggccggcggggagggg 19
|||||||||||||||||||
Sbjct: 10073 cccggccggcggggagggg 10091
>EP03242(+) Os AK065245; range -9999 to 6000.
Length = 16000
Score = 36.2 bits (18), Expect = 0.066
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 15 agggggagcccgcggccg 32
||||||||||||||||||
Sbjct: 5764 agggggagcccgcggccg 5781
>EP01641(+) Os AK121114; range -9999 to 6000.
Length = 16000
Score = 36.2 bits (18), Expect = 0.066
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 13 ggagggggagcccgcggc 30
||||||||||||||||||
Sbjct: 10119 ggagggggagcccgcggc 10136
>EP12097(+) Os AK121236; range -9999 to 6000.
Length = 16000
Score = 34.2 bits (17), Expect = 0.26
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 5 gccggcggggaggggga 21
|||||||||||||||||
Sbjct: 11386 gccggcggggaggggga 11370
>EP11440(+) Os AK062250; range -9999 to 6000.
Length = 16000
Score = 34.2 bits (17), Expect = 0.26
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 12 gggagggggagcccgcg 28
|||||||||||||||||
Sbjct: 4337 gggagggggagcccgcg 4321
>EP11310(+) Os AK073072; range -9999 to 6000.
Length = 16000
Score = 34.2 bits (17), Expect = 0.26
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggagc 23
|||||||||||||||||
Sbjct: 9809 cggcggggagggggagc 9793
>EP04549(+) Os AK072826; range -9999 to 6000.
Length = 16000
Score = 34.2 bits (17), Expect = 0.26
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 3 cggccggcggggagggg 19
|||||||||||||||||
Sbjct: 15814 cggccggcggggagggg 15798
>EP00560(+) Os AK069317; range -9999 to 6000.
Length = 16000
Score = 34.2 bits (17), Expect = 0.26
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 5 gccggcggggaggggga 21
|||||||||||||||||
Sbjct: 3353 gccggcggggaggggga 3369
>EP13370(+) Os AK065945; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10364 cggcggggagggggag 10349
>EP12507(+) Os AK060693; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 4219 cggcggggagggggag 4234
>EP12371(+) Os AK059451; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 591 cggcggggagggggag 606
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 5 gccggcggggagggg 19
|||||||||||||||
Sbjct: 339 gccggcggggagggg 353
>EP11961(+) Os AK120318; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10170 cggcggggagggggag 10155
>EP10967(+) Os AK068200; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 2908 cggcggggagggggag 2923
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 5 gccggcggggagggg 19
|||||||||||||||
Sbjct: 2656 gccggcggggagggg 2670
>EP10028(+) Os AK108849; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 5 gccggcggggaggggg 20
||||||||||||||||
Sbjct: 9086 gccggcggggaggggg 9101
>EP09645(+) Os AK067786; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 5 gccggcggggaggggg 20
||||||||||||||||
Sbjct: 10501 gccggcggggaggggg 10486
>EP09320(+) Os AK101631; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 5 gccggcggggaggggg 20
||||||||||||||||
Sbjct: 10264 gccggcggggaggggg 10279
>EP07644(+) Os AK065427; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10126 cggcggggagggggag 10111
>EP06820(+) Os AK119782; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 15582 cggcggggagggggag 15597
>EP06694(+) Os AK069422; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 2397 cggcggggagggggag 2382
>EP05795(+) Os AK067089; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10188 cggcggggagggggag 10203
>EP05768(+) Os AK065076; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 15058 cggcggggagggggag 15043
>EP05758(+) Os AK103812; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 15109 cggcggggagggggag 15094
>EP05728(+) Os AK100054; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10310 cggcggggagggggag 10325
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10137 cggcggggagggggag 10122
>EP05499(+) Os AK063364; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10266 cggcggggagggggag 10251
>EP05430(+) Os AK070498; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 6273 cggcggggagggggag 6288
>EP05039(+) Os AK070924; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10121 cggcggggagggggag 10106
>EP04972(+) Os AK106231; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 12 gggagggggagcccgc 27
||||||||||||||||
Sbjct: 15912 gggagggggagcccgc 15927
>EP04958(+) Os AK059827; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 5 gccggcggggaggggg 20
||||||||||||||||
Sbjct: 15424 gccggcggggaggggg 15409
>EP03823(+) Os AK063727; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 6011 cggcggggagggggag 6026
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 5838 cggcggggagggggag 5823
>EP03293(+) Os AK061747; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10352 cggcggggagggggag 10367
>EP03249(+) Os AK060100; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 14980 cggcggggagggggag 14995
>EP02783(+) Os AK070181; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 13622 cggcggggagggggag 13607
>EP02731(+) Os AK107501; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 6402 cggcggggagggggag 6417
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 6229 cggcggggagggggag 6214
>EP02297(+) Os AK102861; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 516 cggcggggagggggag 501
>EP01771(+) Os AK060541; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 5 gccggcggggaggggg 20
||||||||||||||||
Sbjct: 1105 gccggcggggaggggg 1090
>EP01273(+) Os AK059858; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 5 gccggcggggaggggg 20
||||||||||||||||
Sbjct: 8432 gccggcggggaggggg 8417
>EP00944(+) Os AK064975; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 4597 cggcggggagggggag 4582
>EP00781(+) Os AK100623; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 22/24 (91%)
Strand = Plus / Plus
Query: 7 cggcggggagggggagcccgcggc 30
||||| ||||| ||||||||||||
Sbjct: 10610 cggcgcggaggcggagcccgcggc 10633
>EP00559(+) Os AK070121; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 7 cggcggggagggggag 22
||||||||||||||||
Sbjct: 10193 cggcggggagggggag 10208
>EP73556(+) Hs HIF1A; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 3 cggccggcggggaggg 18
||||||||||||||||
Sbjct: 10589 cggccggcggggaggg 10574
>EP73097(+) Hs HSPCA; range -9999 to 6000.
Length = 16000
Score = 32.2 bits (16), Expect = 1.0
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 17 ggggagcccgcggccg 32
||||||||||||||||
Sbjct: 10270 ggggagcccgcggccg 10255
>EP13369(+) Os AK065943; range -9999 to 6000.
Length = 16000
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 5 gccggcggggagggg 19
|||||||||||||||
Sbjct: 6076 gccggcggggagggg 6090
>EP13232(+) Os AK064643; range -9999 to 6000.
Length = 16000
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 8 ggcggggagggggag 22
|||||||||||||||
Sbjct: 12566 ggcggggagggggag 12552
>EP13203(+) Os AK064565; range -9999 to 6000.
Length = 16000
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 8 ggcggggagggggag 22
|||||||||||||||
Sbjct: 12836 ggcggggagggggag 12822
>EP13134(+) Os AK064379; range -9999 to 6000.
Length = 16000
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 5 gccggcggggagggg 19
|||||||||||||||
Sbjct: 3423 gccggcggggagggg 3409
>EP12931(+) Os AK063437; range -9999 to 6000.
Length = 16000
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 4 ggccggcggggaggg 18
|||||||||||||||
Sbjct: 3648 ggccggcggggaggg 3634
>EP12283(+) Os AK058648; range -9999 to 6000.
Length = 16000
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 4 ggccggcggggaggg 18
|||||||||||||||
Sbjct: 10140 ggccggcggggaggg 10154
>EP12026(+) Os AK120762; range -9999 to 6000.
Length = 16000
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 4 ggccggcggggaggg 18
|||||||||||||||
Sbjct: 10968 ggccggcggggaggg 10982
>EP11943(+) Os AK120176; range -9999 to 6000.
Length = 16000
Score = 30.2 bits (15), Expect = 4.1
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 8 ggcggggagggggag 22
|||||||||||||||
Sbjct: 13759 ggcggggagggggag 13773
Database: epd
Posted date: Apr 14, 2006 5:00 AM
Number of letters in database: 76,960,000
Number of sequences in database: 4810
Database: epd_bulk
Posted date: Apr 14, 2006 5:01 AM
Number of letters in database: 208,736,000
Number of sequences in database: 13,046
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 9516
Number of Sequences: 17856
Number of extensions: 9516
Number of successful extensions: 1046
Number of sequences better than 10.0: 112
length of query: 34
length of database: 285,696,000
effective HSP length: 16
effective length of query: 18
effective length of database: 285,410,304
effective search space: 5137385472
effective search space used: 5137385472
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)
Thank you for using BLAST2.0